Introduction

Since the first commercialization of genetically modified (GM) crops which known as living modified organism in 1996, the area dedicated to cultivation of GM crops has steadily increased to 189.8 million hectares worldwide (ISAAA, 2017). Major GM crops include maize, soybean, cotton, rapeseed, and more recently, alfalfa (Medicago sativa L.), which has emerged as an important perennial forage crop. Alfalfa, a member of the family Fabaceae, is the most important perennial forage crop for dairy cattle, and is also used for improving rhizosphere fertility (Tesfaye et al., 2005).

Intensive research into genetically engineering of alfalfa has been conducted to improve its agronomic performance, forage quality, and industrial attributes (Kumar, 2011). Most research has focused on applying transgenic methods to improve forage quality (Guo et al., 2001; Le et al., 2017; Reddy et al., 2005), increase resistance to abiotic stressors such as salt and drought (Bao et al., 2009; Jiang et al., 2009; Jin et al., 2010; Zhang et al., 2012), increase herbicide resistance (D’Halluin et al., 1990), and to induce the production of novel compounds (Lee et al., 2008; Peréz Aguirreburualde et al., 2013; Saruul et al., 2002; Vlahova et al., 2005). To date, all GM alfalfa have been developed by Monsanto Corporation, with the incorporation of herbicide resistance (called Roundup Ready alfalfa) and/or lignin biosynthesis inhibition (called reduced lignin alfalfa); these varieties have been approved in many countries, including South Korea. The varieties J101 and J163 include the transgene CP4 epsps, which provides resistance to the herbicide glyphosate under the control of the FMV promoter. KK179 was developed with the RNA interference (RNAi) technique to suppress the endogenous caffeoyl-CoA-3-O-methyltransferase (CCOMT) gene, a key enzyme in S lignin production (Barros et al., 2019). These three single traits (J101, J163, and KK179) and two stack traits (J101×J163 and KK179×J101) are authorized for food and feed production, and have been deregulated for cultivation in the USA, Canada, Japan, Mexico, and Argentina.

Detection and identification of GM alfalfa is currently performed using real-time polymerase chain reaction (qPCR) methods (Guertler et al., 2019). For regulatory purposes, we developed the event-specific qPCR method using plasmid standards due to the lack of available reference materials (RMs). We synthesized plasmids after searching patents for available data and validated the detection method in-house. We designed the event-specific primer and probes with FAM, ZEN, and IBFQ for qPCR, and the amplification sizes were 102 bp (J101), 118 bp (J163), and 178 bp (KK179). The establishment of a reliable, rapid, and cost-effective identification method for GM alfalfa is crucial for the regulation of transboundary movement. Quantitative PCR is highly sensitive and does not require gel electrophoresis, but conventional multiplex PCR is suitable for qualitative analysis and can be implemented in under-equipped laboratories.

The aim of this study was to establish an event-specific multiplex PCR detection method for three GM alfalfa traits (J101, J163, and KK179) based on the available genetic information. To validate the methods according to the general genetically modified organism (GMO) testing method, we performed limit of detection (LOD) assays and random RM DNA analysis. To assess the broad applicability of our multiplex PCR method, we applied it to analysis of feral alfalfa specimens from South Korea. Based on these results, we suggest that the multiplex PCR method is suitable for the detection and identification of three GM alfalfa in samples.

Materials|Methods

Reference materials and feral alfalfa specimens

RMs for GM alfalfa (J101, J163, and KK179) were obtained from the National Institute of Food and Drug Safety Evaluation (NIFDS, Cheongju, Korea). A total of 91 feral alfalfa specimens collected from 2000 to 2018 in South Korea were obtained from the National Institute of Biological Resources (NIBR, Incheon, Korea). Dried alfalfa leaf tissues were stored at −80°C until DNA extraction.

DNA extraction

Plant genomic DNA was extracted from alfalfa RMs and from the leaf tissue of feral alfalfa using a Nucleic Acid Extractor (NP986; Tianlong, Xi'an, China) and Nucleic Acid Extraction kit (T085H, Tianlong, China), following the manufacturer’s protocol. Total DNA amounts were measured by the spectrophotometer ND-2000 (Thermo Fisher Scientific, Wilmington, DE, USA), and the final concentration was adjusted to 50 ng/µL for PCR. All extracted DNA was stored at −20°C until use.

PCR analysis

Genetic information for the three GM alfalfas was obtained from patents and from a previous study (Guertler et al., 2019). Event specific primers were designed for establishing the multiplex PCR, and β-actin (GenBank accession no. EU664318) was used for PCR control. The primers were synthesized by Macrogen Inc. (Seoul, Korea), and were diluted in nuclease-free water (Qiagen, Hilden, Germany) to 100 µM. For the PCR analysis, we used the 2X EF-Taq PCR Pre-Mix (Solgent, Daejeon, Korea) with each batch of genomic DNA (50 ng) and event specific primers (0.2 µM) in 30 µL total reaction volume. A Proplex PCR system (Applied Biosystems, Waltham, MA, USA) was applied for establishment and identification of GM alfalfa according to the following steps: pre-denaturation at 95°C for 5 minutes; 35 cycles consisting of denaturation at 95°C for 0.5 minutes, annealing at 59°C for 0.5 minutes, and extension at 72°C for 0.5 minutes; and 1 cycle of final extension at 72°C for 10 minutes. A 10 µL aliquot of each PCR product was resolved using gel electrophoresis on 2.5% (w/v) agarose gel at constant voltage (135 V) for 25 minutes, and the images were captured by Chemi-Doc XRS+ (Bio-Rad, Hercules, CA, USA).

Sensitivity and application of multiplex PCR

To verity the efficiency of the GM alfalfa multiplex PCR method, we performed LOD analysis using serial dilution of RM DNA of the three GM alfalfas, multiplex PCR with randomly mixed RM DNA templates, and feral alfalfa sample analysis. The three RM DNA mixture was serially diluted with non-GM alfalfa genomic DNA for LOD assay (100, 50, 25, 12.5, 6.3, 3.1, 1.6, 0.8, 0.4, 0.2, 0 ng/µL). Random mixed RM DNA samples were used to test the specificity of the multiplex PCR method. To test the practical application of the multiplex PCR method for the analysis of feral alfalfa samples, dried leaf samples of 91 specimens from NIBR were analyzed.

Results

Establishment of multiplex PCR

To develop the alfalfa multiplex PCR method, we acquired genetic information for three GM alfalfa events (Fig. 1) and designed event-specific PCR primers (Table 1). Each specific primer for flanking the alfalfa genome sequence and each transgene cassette were validated, and the primers without non-specific amplification were selected. As a result, all PCR primers showed event specific amplification for each GM alfalfa event (Fig. 2). These results indicate that the GM alfalfa multiplex PCR is capable of simultaneously detecting each event with high specificity.

Sensitivity of multiplex PCR

The genomic DNA amounts of GMO volunteers or of processed food yield low quality DNA for GMO identification. The minimum level of quality at which sample genomic DNA can be successfully used for multiplex PCR is therefore essential to define (Choi et al., 2018). The LOD was tested using a serially diluted three GM alfalfa genomic DNA mixture (Fig. 3A). The multiplex PCR band was detectable at the 12.5 ng/µL concentration of the DNA mixture, but the recommended minimum DNA amount to effectively perform the analysis is 12.5 ng/µL.

The random mixed alfalfa RM DNA was used to confirm the efficiency and sensitivity of the alfalfa multiplex PCR method. The alfalfa multiplex PCR method was able to effectively identify the constituents of all random RM DNA mixtures (Fig. 3B). These results indicate that the multiplex PCR method is sufficient to identify all GM alfalfa single and stacked events, including the two GM alfalfa stack events (J101×J163 and KK179×J101) that are currently approved in South Korea.

Application of the multiplex PCR

The multiplex PCR method for GMO identification has been applied for detection of GM volunteers, which were collected from GMO monitoring (Choi et al., 2018; Eum et al., 2019; Jo et al., 2016; Shin et al., 2016). To apply the multiplex PCR method for alfalfa sample analysis, we performed PCR with feral alfalfa specimens from NIBR in South Korea (Table 2). The 91 alfalfa specimens collected from 2000 to 2018 were analyzed using the newly developed alfalfa multiplex to identify unintentionally released GM alfalfa in the natural environment (Fig. 4). No GM alfalfa were detected using the multiplex PCR, and these results were confirmed by simplex PCR performed with each event-specific PCR primer (data not shown).

Discussion

Over 500 GM events, including stacked events, have been authorized worldwide (ISAAA, 2017). Implementation of management policy is typically based on the presence or absence of GM DNA or protein in tested samples. Because GM crop companies are continuously developing new GM-events, detection and identification methods for these events must be established in order for management to be successful. As the variety of commercially available GM crops has increased, the use of multiple GMO detection systems has become routine. A multiplex detection system using conventional PCR would be a powerful tool for the detection and quantification of transgenic elements.

Alfalfa has been used as livestock feed for decades because of its high forage quality. Alfalfa is also used for various non-agricultural purposes such as rehabilitation of rangelands, erosion control and reduction in forests and mined soils, and in revegetation of damaged land (Sullivan, 1992). In South Korea, alfalfa seed has been used for erosion protection on road cut slopes via seed spray for many years, possibly leading to unintentional release of GM alfalfa into the natural environment. To monitor the release of GM alfalfa into nature, it is necessary to establish time and cost effective detection methods. The GMO environmental monitoring program in the Ministry of Environment (MOE) and the National Institute of Ecology (NIE) in South Korea has searched for volunteers of GM maize, soybean, canola, and cotton since 2009 (Eum et al., 2019), and we have recently added alfalfa for GMO monitoring due to the steady increase in alfalfa imports and the increasing proliferation of wild alfalfa (NIE, 2018). Reliable detection methods for GM alfalfa will enable the identification of volunteers and the informed management of GMOs released in nature.

Event-specific detection methods for three GM alfalfas by real-time PCR have been developed (Guertler et al., 2019). The present study established specific qPCR detection methods for alfalfa events J101, J163, and KK179 and validated the methods according to the EU guidelines for GMO testing. For in-house validation, the research group performed LOD and robustness tests with thermal cyclers. An inter-laboratory comparison study was also performed by seven laboratories organized by the Federal Office of Consumer Protection and Food Safety (BVL). These methods would provide a powerful tool for the qualitative and quantitative detection of GM alfalfa, but many under-equipped laboratories in developing countries lack the expensive equipment and materials, including probes and reagents that are necessary for the application of this system. To overcome these limitations, we developed a fast and cost effective multiplex PCR method using event-specific primers. To successfully detect GM alfalfa using multiplex PCR, the size of the PCR products should be easily separated by gel electrophoresis. In this study, we designed specific primers for J163, J101, and KK179 (Table 1). J101 and J163 were developed with the same transgene cassette to exhibit herbicide resistance (Fig. 1), and primers specific to the transgene and plant genome were therefore necessary to identify J101 and J163. Moreover, to reduce primer interference in the multiplex PCR, we applied the same transgene binding primer (J163-F and J101-F) for J101 and J163 (Table 1). The amplicon length of PCR for each amplification is crucial for the successful development of the multiplex PCR method (Mathuoka et al., 2001). We performed the event-specific multiplex PCR using primers for 98 bp (J163), 202 bp (J101), and 347 bp (KK179) to separate PCR products in 2.5% agarose gel (Fig. 2). The PCR amplification yielded variable sizes of separation in the agarose gel without the long run time of electrophoresis. These results indicate that the newly developed multiplex PCR method is suitable for identifying the three GM alfalfas in one reaction, possibly reducing the time and cost necessary to perform the analysis.

To evaluate the sensitivity of the multiplex PCR method, we conducted an LOD assay and random RM DNA mixture analysis. Serially diluted alfalfa gDNA mixtures (100–0.2 ng/µL) were used for multiplex PCR, and the amplification strength was decreased by DNA concentration dependently. The minimum concentration at which the multiplex PCR band was detectable was 12.5 ng/µL, but we recommended that 12.5 ng/µL should be used for qualitative analysis. The majority of GM volunteers detected by GMO monitoring have been homozygotes or heterozygotes, indicating that the absolute quantity of genomic DNA is critical for GMO identification (in press). In a comparison of single event and stacked event PCR (Fig. 3B), the amplification strength of single event PCR was greater than that of three stacked event PCR. These results indicate that the minimum concentration of genomic DNA from volunteer plants needed to detect GM alfalfa.

Feral alfalfa is commonly observed on roadsides and natural habitats from East Asia to Europe, and in South Africa, Australia, and North and South America (Michaud et al., 1988). In South Korea, alfalfa plants and their seeds are used for forage and to prevent soil erosion of cut slopes. Because of low self-sufficiency of alfalfa, the majority of alfalfa plants and seeds are imported. Moreover, according to the Act on Transboundary Movement of GMOs in South Korea, a 3% labeling threshold for GM seeds could be allowed for crop trade. For these reasons, there is a high likelihood of the release of GM alfalfa seed into the natural environment. To monitor the unintentional release of GM alfalfa to the natural environment, it is necessary to establish a detection system for all GM alfalfas currently approved in South Korea. In this study, we used 91 feral alfalfa specimens collected from natural habitats between 2000 and 2018 to screen for unintentionally released GM alfalfa. The feral alfalfa samples were collected from natural environmental sites nearby open area and roadside in the Korean peninsula, including Baengnyeong Island and Jeju Island (Fig. 4A). The results of our feral alfalfa specimen analysis by alfalfa multiplex PCR indicated that no GM alfalfa has yet been released in South Korea (Fig. 4B). However, there is still an increased risk of environmental release of GM alfalfa, and the management of GM alfalfa seeds must be enforced. In conclusion, our newly developed GM alfalfa detection method using conventional multiplex PCR is suitable for single and stack event analysis and applicable for the analysis and identification of GM events in feral alfalfa.

Acknowledgments

This work was supported by a grant from the National Institute of Ecology (NIE), funded by the Ministry of Environment (MOE) of the Republic of Korea (NIE-A-2020-06, NIE-A-2020-07). The feral alfalfa specimens used in this study were provided by the National Institute of Biological Resources (NIBR202002101).

Acknowledgement

Author Contributions

JRL and WC conceived of and designed the experiments. IRK and HSL performed all experiments and collected the plant samples. WC and IRK wrote the paper. All authors read and approved the final manuscript.

Conflict of Interest

The authors declare that they have no competing interests.

References

1 

BaoA.K., WangS.M., WuG.Q., XiJ.J., ZhangJ.L., WangC.M. (2009). Overexpression of the Arabidopsis H+-PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L.). Plant Science, 176, 232-240.

2 

BarrosJ., TempleS., DixonR.A. (2019). Development and commercialization of reduced lignin alfalfa. Current Opinion in Biotechnology, 56, 48-54, https://doi.org/10.1016/j.copbio.2018.09.003, pubmed id:30268938.

3 

ChoiW., SeolM.A., JoB.H., KimI.R., LeeJ.R. (2018). Development and application of a novel multiplex PCR method for four living modified soybeans. Applied Biological Chemistry, 61, 635-641.

4 

D'HalluinK., BottermanJ., De GreefW. (1990). Engineering of herbicide-resistant alfalfa and evaluation under field conditions. Crop Science, 30, 866-871.

5 

EumS., KimI.R., LimH.S., LeeJ.R., ChoiW. (2019). Event-specific multiplex PCR method for four genetically modified cotton varieties, and its application. Applied Biological Chemistry, 62, 52.

6 

GuertlerP., GrohmannL., NaumannH., PavlovicM., BuschU. (2019). Development of event-specific qPCR detection methods for genetically modified alfalfa events J101, J163 and KK179. Biomolecular Detection and Quantification, 17, 100076, https://doi.org/10.1016/j.bdq.2018.12.001, pubmed id:30984566, PMC6446038.

7 

GuoD., ChenF., InoueK., BlountJ.W., DixonR.A. (2001). Downregulation of caffeic acid 3-O-methyltransferase and caffeoyl CoA 3-O-methyltransferase in transgenic alfalfa. Impacts on lignin structure and implications for the biosynthesis of G and S lignin. The Plant Cell, 13, 73-88, https://doi.org/10.1105/tpc.13.1.73, pubmed id:11158530, PMC102215.

8 

ISAAA. ISAAA, 2017, Global status of commercialized biotech/GM crops in 2017: biotech crop adoption surges as economic benefits accumulate in 22 years, from , http://www.isaaa.org/resources/publications/briefs/53/default.asp, Retrieved July 1, 2020.

9 

JinT., ChangQ., LiW., YinD., LiZ., WangD., et al. (2010). Stress-inducible expression of GmDREB1 conferred salt tolerance in transgenic alfalfa. Plant Cell Tissue and Organ Culture, 100, 219-227.

10 

JiangQ., ZhangJ.Y., GuoX., MonterosM.J., WangZ.Y. (2009). Physiological characterization of transgenic alfalfa (Medicago sativa) plants for improved drought tolerance. International Journal of Plant Sciences, 170, 969-978.

11 

JoB.H., SeolM.A., ShinS.Y., KimI.R., ChoiW., EumS.J., et al. (2016). Multiplex PCR method for environmental monitoring of approved LM cotton events in Korea. Journal of Plant Biotechnology, 43, 91-98.

12 

KumarS. (2011). Biotechnological advancements in alfalfa improvement. Journal of Applied Genetics, 52, 111-124, https://doi.org/10.1007/s13353-011-0028-2, pubmed id:21279557.

13 

LeiY., HannoufaA., YuP. (2017). The use of gene modification and advanced molecular structure analyses towards improving alfalfa forage. International Journal of Molecular Sciences, 18, 298, https://doi.org/10.3390/ijms18020298, pubmed id:28146083, PMC5343834.

14 

LeeR.W., CornelisseM., ZiauddinA., SlackP.J., HodginsD.C., StrommerJ.N., et al. (2008). Expression of a modified Mannheimia haemolytica GS60 outer membrane lipoprotein in transgenic alfalfa for the development of an edible vaccine against bovine pneumonic pasteurellosis. Journal of Biotechnology, 135, 224-231, https://doi.org/10.1016/j.jbiotec.2008.03.006, pubmed id:18440084.

15 

MatsuokaT., KuribaraH., AkiyamaH., MiuraH., GodaY., KusakabeY., et al. (2001). A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize. Journal of the Food Hygienic Society of Japan, 42, 24-32, https://doi.org/10.3358/shokueishi.42.24, pubmed id:11383153.

16 

MichaudR., LehmanW.F., RumbaughM.D., HansonA.A., BarnesD.K., HillR.R. (Eds.). (1988). Alfalfa and Alfalfa Improvement. Madison: American Society of Agronomy. World distribution and historical development, pp. 25-91.

17 

NIE. (2018). Study on Environmental Monitoring and Post-management of LMO. Seocheon: NIE.

18 

Peréz AguirreburualdeM.S., GómezM.C., OstachukA., WolmanF., AlbanesiG., PecoraA., et al. (2013). Efficacy of a BVDV subunit vaccine produced in alfalfa transgenic plants. Veterinary Immunology and Immunopathology, 151, 315-324, https://doi.org/10.1016/j.vetimm.2012.12.004, pubmed id:23291101.

19 

ReddyM.S., ChenF., ShadleG., JacksonL., AljoeH., DixonR.A. (2005). Targeted down-regulation of cytochrome P450 enzymes for forage quality improvement in alfalfa (Medicago sativa L.). Proceedings of the National Academy of Sciences of the United States of America, 102, 16573-16578, https://doi.org/10.1073/pnas.0505749102, pubmed id:16263933, PMC1283808.

20 

SaruulP., SriencF., SomersD.A., SamacD.A. (2002). Production of a biodegradable plastic polymer, poly-β-hydroxybutyrate, in transgenic alfalfa. Crop Science, 42, 919-927.

21 

ShinS.Y., LimH.S., SeolM.A., JungY.J., KimI.R., SongH.R., et al. (2016). Four multiplex PCR sets of 11 LM maize for LMO environmental monitoring in Korea. Journal of Plant Biotechnology, 43, 473-478.

22 

SullivanJ. 1992, Medicago sativa, from , https://www.fs.fed.us/database/feis/plants/forb/medsat/all.html, Retrieved July 1, 2020.

23 

TesfayeM., DentonM.D., SamacD.A., VanceC.P. (2005). Transgenic alfalfa secretes a fungal endochitinase protein to the rhizosphere. Plant and Soil, 269, 233-243.

24 

VlahovaM., StefanovaG., PetkovP., BarbulovaA., PetkovaD., KalushkovP., et al. (2005). Genetic modification of alfalfa (Medicago Sativa L.) for quality improvement and production of novel compounds. Biotechnology and Biotechnological Equipment, 19(Suppl 3), 56-62.

25 

ZhangY.M., LiuZ.H., WenZ.Y., ZhangH.M., YangF., GuoX.L. (2012). The vacuolar Na+-H+ antiport gene TaNHX2 confers salt tolerance on transgenic alfalfa (Medicago sativa). Functional Plant Biology, 39, 708-716, https://doi.org/10.1071/FP12095, pubmed id:32480822.

Figures and Tables

새창으로 보기
Figure 1

Schematic diagrams of PCR primer positions for the three LM alfalfa events (A, J163; B, J101; C, KK179). The locations and the primers are indicated by arrows. The vertical bold lines represent the flanking region of alfalfa genome (RB, right border; LB, left border; F, forward primer; R, reverse primer; gray pentagon, Promoter; open square, coding gene; gray square, 3’ terminator).

PNIE-1-083-f1.jpg
새창으로 보기
Figure 2

Establishment of multiplex polymerase chain reaction (PCR). (A) Schematic diagram of the optimal multiplex PCR condition. (B) Agarose gel image using multiplex PCR method for alfalfa genomic DNA. lane 1, J163; lane 2, J101; lane 3, KK179; lane 4, Non-LM alfalfa; lane 5, mixed reference materias; M, bp marker.

PNIE-1-083-f2.jpg
새창으로 보기
Figure 3

Sensitivity of multiplex PCR. (A) LOD of multiplex PCR for three alfalfa events with serial diluted mixed DNA template. (B) Efficiency of multiplex PCR using a random mixture of genomic DNA of alfalfa RMs. PCR, polymerase chain reaction; LOD, limit of detection; RMs, reference materials; M, 100 bp marker.

PNIE-1-083-f3.jpg
새창으로 보기
Figure 4

Application of the multiplex polymerase chain reaction (PCR) method for analysis of the 91 feral alfalfa specimens. (A) Locations of alfalfa sample collection sites. Filled circles exhibit the location of a feral alfalfa specimen collection site. (B) Analysis of multiplex PCR using 91 samples (lane 1, non-GMO; lane 2, J163; lane 3, J101; lane 4, KK179; lane 5, mixed three reference materials; S01-S91; number of specimen samples; M, 100 bp marker).

PNIE-1-083-f4.jpg
새창으로 보기
Table 1

Oligonucleotide primers used for multiplex PCR method to detect three LM alfalfa events

Event Primer name Sequence (5’-3’) Product size (bp)
J163 J163-F GGACTGAGAATTAGCTTCCA 98
J163-R ACAAGGTCATCCAAACTGAA
J101 J101-F GGACTGAGAATTAGCTTCCA 202
J101-R ATCTTTACAGTGACAATGTATATGGA
KK179 KK179-F GTCTTCAAAATACAAGTCAAACAC 347
Kk179-R CTTTCATTTTATAATAACGCTGCG
β-actin β-actin-F GTCTCTCACGATTTCGCGCT 147
β-actin-R GTTCCTATCTATGAAGGATATGCCC
[i]

F, forward primer; R, reverse primer.

새창으로 보기
Table 2

Information of feral alfalfa specimens examined in this study

No. Specimen No. No. Specimen No. No. Specimen No.
S04 NIBRVP0000501595 S05 NIBRVP0000292518 S06 NIBRVP0000292523
S07 NIBRVP0000292517 S08 NIBRVP0000441696 S09 NIBRVP0000292533
S10 NIBRVP0000292513 S11 NIBRVP0000292514 S12 NIBRVP0000292516
S13 NIBRVP0000436383 S14 NIBRVP0000354456 S15 NIBRVP0000375266
S16 NIBRVP0000398052 S17 NIBRVP0000385357 S18 NIBRVP0000292529
S19 NIBRVP0000292525 S20 NIBRVP0000292524 S21 NIBRVP0000292522
S22 NIBRVP0000292521 S23 NIBRVP0000292520 S24 NIBRVP0000209546
S25 NIBRVP0000308143 S26 NIBRVP0000303892 S27 NIBRVP0000303891
S28 NIBRVP0000305367 S29 NIBRVP0000317390 S30 NIBRVP0000317395
S31 NIBRVP0000130307 S32 NIBRVP0000428425 S33 NIBRVP0000430227
S34 NIBRVP0000130306 S35 NIBRVP0000130305 S36 NIBRVP0000292527
S37 NIBRVP0000292520 S38 NIBRVP0000489731 S39 NIBRVP0000489213
S40 NIBRVP0000487003 S41 NIBRVP0000555041 S42 NIBRVP0000584727
S43 NIBRVP0000584033 S44 NIBRVP0000595744 S45 NIBRVP0000587621
S46 NIBRVP0000548652 S47 NIBRVP0000350272 S48 NIBRVP0000350674
S49 NIBRVP0000439717 S50 NIBRVP0000575558 S51 NIBRVP0000587695
S52 NIBRVP0000592403 S53 NIBRVP0000575852 S54 NIBRVP0000575853
S55 NIBRVP0000587027 S56 NIBRVP0000606411 S57 NIBRVP0000348540
S58 NIBRVP0000180475 S59 NIBRVP0000230317 S60 NIBRVP0000139629
S61 NIBRVP0000240944 S62 NIBRVP0000217170 S63 NIBRVP0000119898
S64 NIBRVP0000120825 S65 NIBRVP0000120826 S66 NIBRVP0000207750
S67 NIBRVP0000112397 S68 NIBRVP0000456918 S69 NIBRVP0000292526
S70 NIBRVP0000386967 S71 NIBRVP0000305407 S72 NIBRVP0000308144
S73 NIBRVP0000429882 S74 NIBRVP0000308142 S75 NIBRVP0000209991
S76 NIBRVP0000480382 S77 NIBRVP0000477472 S78 NIBRVP0000292519
S79 NIBRVP0000357281 S80 NIBRVP0000292515 S81 NIBRVP0000397803
S82 NIBRVP0000397448 S83 NIBRVP0000375414 S84 NIBRVP0000375030
S85 NIBRVP0000672868 S86 NIBRVP0000638956 S87 NIBRVP0000539399
S88 NIBRVP0000601290 S89 NIBRVP0000603483 S90 NIBRVP0000452750
S89 NIBRVP0000603483 S90 NIBRVP0000452750 S91 NIBRVP0000620900
S90 NIBRVP0000452750 S91 NIBRVP0000620900